Getting Started

This page is the fastest useful path from installation to a checked DotMatch run. It assumes you have FASTQ or FASTQ.gz reads and a table of expected short DNA targets such as guides, sample barcodes, feature barcodes, primers, or adapter prefixes.

Install

For the current release target after PyPI publication:

python3 -m pip install dotmatch==0.1.9
dotmatch --version

For Conda-based environments, use the 0.1.9 Bioconda package after the recipe update has been accepted and make distribution-channels verifies the channel:

conda create -n dotmatch -c conda-forge -c bioconda dotmatch=0.1.9
conda activate dotmatch
dotmatch --version

From a source checkout:

git clone https://github.com/dnncha/dotmatch.git
cd dotmatch
make
python3 -m pip install .
dotmatch --version

The source build needs a C compiler, make, Python 3.9 or newer, and zlib for FASTQ.gz support.

PyPI remains the simplest cross-platform Python install path. Bioconda is the preferred package-manager path for Conda-based bioinformatics environments after the release package appears in Bioconda repodata and passes a clean install smoke test.

Prepare Targets

Targets are ordinary tabular records with an identifier and sequence. Keep the file small and explicit: one expected guide, barcode, primer, feature tag, or panel target per row.

target_id	sequence
guide_001	ACGTACGTACGTACGTACGT
guide_002	ACGTACGTACGTACGTAGGT
guide_003	TGCATGCATGCATGCATGCA

Before allowing error correction, audit the target table:

dotmatch audit \
  --targets guides.tsv \
  --k 1 \
  --audit-mode auto \
  --out-dir audit/

Review duplicate sequences, near-neighbor targets, and ambiguous example queries before using --k 1 or higher in production. A target set that is not safe for correction should usually be counted exactly or redesigned.

Count Known Targets From FASTQ

Use dotmatch count when reads contain one fixed target window.

dotmatch count \
  --targets guides.tsv \
  --reads sample_R1.fastq.gz \
  --sample-label sample_1 \
  --target-start 23 \
  --target-length 20 \
  --k 1 \
  --metric hamming \
  --ambiguity-policy radius \
  --out counts.tsv \
  --target-counts-long target_counts.long.tsv \
  --sample-qc sample_qc.tsv \
  --assignments assignments.tsv \
  --summary summary.json

Use Hamming distance when all targets and read windows have the same length and only substitutions should be corrected. Use Levenshtein distance when one-base insertions or deletions should be considered:

dotmatch count \
  --targets targets.tsv \
  --reads sample_R1.fastq.gz \
  --target-start 0 \
  --target-length 20 \
  --k 1 \
  --metric levenshtein \
  --indel-window 1 \
  --ambiguity-policy radius \
  --out counts.tsv \
  --sample-qc sample_qc.tsv \
  --summary summary.json

The default radius ambiguity policy is conservative: a read is counted only when exactly one target lies inside the configured radius. Use best only when you deliberately need best-distance compatibility with an existing workflow.

Demultiplex Inline Barcodes

For fixed-position inline barcodes:

dotmatch demux \
  --barcodes barcodes.tsv \
  --reads pooled.fastq.gz \
  --barcode-start 0 \
  --barcode-length 8 \
  --k 1 \
  --metric hamming \
  --ambiguity-policy radius \
  --max-correction-qual 20 \
  --out-dir demuxed \
  --summary demux.summary.json \
  --assignments demux.assignments.tsv \
  --ambiguous-out ambiguous.fastq \
  --unmatched-out unmatched.fastq

Open the summary and assignment tables before trusting the split FASTQs. High unmatched, ambiguous, or invalid rates usually mean the barcode start, barcode length, sample sheet, or correction policy needs review.

Diagnose a Barcode Run

barcode autopsy is the quickest way to inspect common failure modes:

dotmatch barcode autopsy \
  --barcodes barcodes.tsv \
  --reads pooled.fastq.gz \
  --scan-starts 0:12 \
  --k-values 0,1 \
  --out-dir autopsy/

Start with autopsy/report.html, then use the TSV and JSON files for pipeline records, lab handoff, or methods review.

Read the Outputs

The most important files are:

  • counts.tsv or target_counts.long.tsv: counts for uniquely assigned reads.

  • sample_qc.tsv: assignment rate, rescue rate, ambiguous reads, unmatched reads, invalid windows, target coverage, and representation metrics.

  • assignments.tsv: per-read assignment states when requested.

  • summary.json: run configuration, assignment policy, and provenance.

  • HTML reports: human-readable review pages for assay, barcode, panel, and QC workflows.

Ambiguous reads are intentionally visible and are not added silently to target counts under the default policy. This is the central trust contract of DotMatch.

Next Steps

  • Use AssaySpec for the full assay new, start, check, and run command reference.

  • Use Command Reference for the current command map.

  • Use CRISPR Count QC before downstream screen statistics.

  • Use Barcode Panel Design when creating or checking barcode panels.

  • Use Public Schemas when integrating DotMatch with Snakemake, Nextflow, MultiQC, notebooks, or LIMS exports.

  • Use Methods and Citation and dotmatch citation when recording the software version in methods sections, reports, or workflow provenance. Release citation metadata is kept in CITATION.cff.