Getting Started
This page is the fastest useful path from installation to a checked DotMatch run. It assumes you have FASTQ or FASTQ.gz reads and a table of expected short DNA targets such as guides, sample barcodes, feature barcodes, primers, or adapter prefixes.
Install
For the current release target after PyPI publication:
python3 -m pip install dotmatch==0.1.9
dotmatch --version
For Conda-based environments, use the 0.1.9 Bioconda package after the recipe
update has been accepted and make distribution-channels verifies the channel:
conda create -n dotmatch -c conda-forge -c bioconda dotmatch=0.1.9
conda activate dotmatch
dotmatch --version
From a source checkout:
git clone https://github.com/dnncha/dotmatch.git
cd dotmatch
make
python3 -m pip install .
dotmatch --version
The source build needs a C compiler, make, Python 3.9 or newer, and zlib for
FASTQ.gz support.
PyPI remains the simplest cross-platform Python install path. Bioconda is the preferred package-manager path for Conda-based bioinformatics environments after the release package appears in Bioconda repodata and passes a clean install smoke test.
Recommended Workflow: Assay Project
The default scientist path is scaffold → check → run → open the reliability report. Start from a guide or target table plus a directory of FASTQ files:
dotmatch assay new crispr \
--library guides.tsv \
--reads-dir fastqs/ \
--out crispr_screen/
Review crispr_screen/inference_report.json, then run the project:
cd crispr_screen
./run.sh
run.sh calls dotmatch assay start assay.toml, which runs preflight check,
executes the assay, and prints the reliability verdict. Open
assay_out/reliability_report.html first. If the verdict is not passed, apply
the suggested edits in assay_out/assay_fixes.tsv and rerun ./run.sh.
The CRISPR namespace exposes the same scaffold:
dotmatch crispr new --library guides.tsv --reads-dir fastqs/ --out crispr_screen/
dotmatch crispr start crispr_screen/assay.toml
Prepare Targets
Targets are ordinary tabular records with an identifier and sequence. Keep the file small and explicit: one expected guide, barcode, primer, feature tag, or panel target per row.
target_id sequence
guide_001 ACGTACGTACGTACGTACGT
guide_002 ACGTACGTACGTACGTAGGT
guide_003 TGCATGCATGCATGCATGCA
Before allowing error correction, audit the target table:
dotmatch audit \
--targets guides.tsv \
--k 1 \
--audit-mode auto \
--out-dir audit/
Review duplicate sequences, near-neighbor targets, and ambiguous example
queries before using --k 1 or higher in production. A target set that is not
safe for correction should usually be counted exactly or redesigned.
Count Known Targets From FASTQ
Use dotmatch count when reads contain one fixed target window.
dotmatch count \
--targets guides.tsv \
--reads sample_R1.fastq.gz \
--sample-label sample_1 \
--target-start 23 \
--target-length 20 \
--k 1 \
--metric hamming \
--ambiguity-policy radius \
--out counts.tsv \
--target-counts-long target_counts.long.tsv \
--sample-qc sample_qc.tsv \
--assignments assignments.tsv \
--summary summary.json
Use Hamming distance when all targets and read windows have the same length and only substitutions should be corrected. Use Levenshtein distance when one-base insertions or deletions should be considered:
dotmatch count \
--targets targets.tsv \
--reads sample_R1.fastq.gz \
--target-start 0 \
--target-length 20 \
--k 1 \
--metric levenshtein \
--indel-window 1 \
--ambiguity-policy radius \
--out counts.tsv \
--sample-qc sample_qc.tsv \
--summary summary.json
The default radius ambiguity policy is conservative: a read is counted only
when exactly one target lies inside the configured radius. Use best only when
you deliberately need best-distance compatibility with an existing workflow.
Demultiplex Inline Barcodes
For fixed-position inline barcodes:
dotmatch demux \
--barcodes barcodes.tsv \
--reads pooled.fastq.gz \
--barcode-start 0 \
--barcode-length 8 \
--k 1 \
--metric hamming \
--ambiguity-policy radius \
--max-correction-qual 20 \
--out-dir demuxed \
--summary demux.summary.json \
--assignments demux.assignments.tsv \
--ambiguous-out ambiguous.fastq \
--unmatched-out unmatched.fastq
Open the summary and assignment tables before trusting the split FASTQs. High unmatched, ambiguous, or invalid rates usually mean the barcode start, barcode length, sample sheet, or correction policy needs review.
Diagnose a Barcode Run
barcode autopsy is the quickest way to inspect common failure modes:
dotmatch barcode autopsy \
--barcodes barcodes.tsv \
--reads pooled.fastq.gz \
--scan-starts 0:12 \
--k-values 0,1 \
--out-dir autopsy/
Start with autopsy/report.html, then use the TSV and JSON files for pipeline
records, lab handoff, or methods review.
Read the Outputs
The most important files are:
counts.tsvortarget_counts.long.tsv: counts for uniquely assigned reads.sample_qc.tsv: assignment rate, rescue rate, ambiguous reads, unmatched reads, invalid windows, target coverage, and representation metrics.assignments.tsv: per-read assignment states when requested.summary.json: run configuration, assignment policy, and provenance.HTML reports: human-readable review pages for assay, barcode, panel, and QC workflows.
Ambiguous reads are intentionally visible and are not added silently to target counts under the default policy. This is the central trust contract of DotMatch.
Next Steps
Use AssaySpec for the full
assay new,start,check, andruncommand reference.Use Command Reference for the current command map.
Use CRISPR Count QC before downstream screen statistics.
Use Barcode Panel Design when creating or checking barcode panels.
Use Public Schemas when integrating DotMatch with Snakemake, Nextflow, MultiQC, notebooks, or LIMS exports.
Use Methods and Citation and
dotmatch citationwhen recording the software version in methods sections, reports, or workflow provenance. Release citation metadata is kept inCITATION.cff.